
                                EMBOSS: cons
     _________________________________________________________________
   
                                 Program cons
                                       
Function

   Creates a consensus from multiple alignments
   
Description

   cons calculates a consensus sequence from a multiple sequence
   alignment. To obtain the consensus, the sequence weights and a scoring
   matrix are used to calculate a score at each position in the
   alignment.
   
   The residue (or nucleotide) i in an alignment column, is compared to
   all other residues (j) in the column. The score for i is the sum over
   all residues j (not i=j) of the score(ij)*weight(j) . Where score(ij)
   is taken from a nucleotide or protein scoring matrix (see -datafile
   qualifier) and the "weight(j)" is the weighting given to the sequence
   j, which is given in the alignment file.
   
   The highest scoring type of residue is then found in the column. If
   the number of positive matches for this residue is greater than the
   "plurality value" then this residue is the consensus. The positive
   matches for a residue i are calculated as being the sum of weights of
   all the residues that increase the score of residue i (i.e. positive).
   
   Where no consensus is found at a position i, an 'n' or an 'x'
   character is output; (depending on it being a DNA or protein
   sequence).
   
   The "plurality" qualifier allows the user to set a cut-off for the
   number of positive matches below which there is no consensus.
   
   The "identity" qualifier provides the facility of setting the required
   number of identities at a site for it to give a consensus at that
   position. Therefore, if this is set to the number of sequences in the
   alignment only columns of identities contribute to the consensus.
   
   The "setcase" qualifier sets the threshold for the positive matches
   above which the consensus is is upper-case and below which the
   consensus is in lower-case.
   
Usage

   Here is a sample session with cons:

% cons
Creates a consensus from multiple alignments
Input sequence set: aligned.fasta
Output file [outfile.cons]: aligned.cons

Command line arguments

   Mandatory qualifiers:
  [-msf]               seqset     File containing a sequence alignment.
  [-outseq]            seqout     Output sequence USA

   Optional qualifiers:
   -datafile           matrix     Scoring matrix
   -plurality          float      Set a cut-off for the number of positive
                                  matches below which there is no consensus.
                                  The default plurality is taken as half the
                                  total weight of all the sequences in the
                                  alignment.
   -identity           integer    Provides the facility of setting the
                                  required number of identities at a site for
                                  it to give a consensus at that position.
                                  Therefore, if this is set to the number of
                                  sequences in the alignment only columns of
                                  identities contribute to the consensus.
   -name               string     Name of the consensus sequence
   -setcase            float      Sets the threshold for the positive matches
                                  above which the consensus is is upper-case
                                  and below which the consensus is in
                                  lower-case.

   Advanced qualifiers: (none)
   General qualifiers:
  -help                bool       report command line options. More
                                  information on associated and general
                                  qualifiers can be found with -help -verbose
   

   Mandatory qualifiers Allowed values Default
   [-msf]
   (Parameter 1) File containing a sequence alignment. Readable sequences
   Required
   [-outseq]
   (Parameter 2) Output sequence USA Writeable sequence <sequence>.format
   Optional qualifiers Allowed values Default
   -datafile Scoring matrix Comparison matrix file in EMBOSS data path
   EBLOSUM62 for protein
   EDNAFULL for DNA
   -plurality Set a cut-off for the number of positive matches below
   which there is no consensus. The default plurality is taken as half
   the total weight of all the sequences in the alignment. Any integer
   value Half the total sequence weighting
   -identity Provides the facility of setting the required number of
   identities at a site for it to give a consensus at that position.
   Therefore, if this is set to the number of sequences in the alignment
   only columns of identities contribute to the consensus. Integer 0 or
   more 0
   -name Name of the consensus sequence Any string is accepted An empty
   string is accepted
   -setcase Sets the threshold for the positive matches above which the
   consensus is is upper-case and below which the consensus is in
   lower-case. Any integer value 0
   Advanced qualifiers Allowed values Default
   (none)
   
Input file format

   The USA of a set of aligned sequences.
   
Output file format

   The output consists of a sequence file holding the consensus sequence.
   For example:
     _________________________________________________________________
   
>EMBOSS_001
tagctgacctgacgggactgatgcgt
     _________________________________________________________________
   
Data files

   It uses the standard set of scoring matrix data files.
   
   EMBOSS data files are distributed with the application and stored in
   the standard EMBOSS data directory, which is defined by the EMBOSS
   environment variable EMBOSS_DATA.
   
   To see the available EMBOSS data files, run:
   
% embossdata -showall

   To fetch one of the data files (for example 'Exxx.dat') into your
   current directory for you to inspect or modify, run:

% embossdata -fetch -file Exxx.dat

   Users can provide their own data files in their own directories.
   Project specific files can be put in the current directory, or for
   tidier directory listings in a subdirectory called ".embossdata".
   Files for all EMBOSS runs can be put in the user's home directory, or
   again in a subdirectory called ".embossdata".
   
   The directories are searched in the following order:
     * . (your current directory)
     * .embossdata (under your current directory)
     * ~/ (your home directory)
     * ~/.embossdata
       
Notes

   None.
   
References

   None.
   
Warnings

   None.
   
Diagnostic Error Messages

   None.
   
Exit status

   It always exits with status 0.
   
Known bugs

   None.
   
See also

   Program name                    Description
   megamerger   Merge two large overlapping nucleic acid sequences
   merger       Merge two overlapping nucleic acid sequences
   
Author(s)

   This application was written by Tim Carver (tcarver@hgmp.mrc.ac.uk)
   
History

   Written (Oct 2000) - Tim Carver
   
Target users

   This program is intended to be used by everyone and everything, from
   naive users to embedded scripts.
   
Comments
