
                              EMBOSS: showorf
     _________________________________________________________________
   
                                Program showorf
                                       
Function

   Pretty output of DNA translations
   
Description

   Showorf displays a nucleic acid sequence with its protein translation
   in a style suitable for publication. The translation can be done in
   any frame or combination of frames.
   
   It uses codon frequency files to do the translation. You can specify
   the codon frequency file that you use with the '-cfile' option. The
   default table is 'Ehum.cut'.
   
Usage

   Here is a sample session with showorf.

% showorf
Pretty output of DNA translations
Input sequence: embl:paamir
Select Frames To Translate
         0 : None
         1 : F1
         2 : F2
         3 : F3
         4 : R1
         5 : R2
         6 : R3
Select one or more values [1,2,3,4,5,6]:
Output file [paamir.showorf]:

Command line arguments

   Mandatory qualifiers:
  [-sequence]          sequence   Sequence USA
   -frames             menu       Select one or more values
  [-outfile]           outfile    Output file name

   Optional qualifiers:
   -[no]ruler          bool       Add a ruler
   -[no]plabel         bool       Number translations
   -[no]nlabel         bool       Number DNA sequence

   Advanced qualifiers:
   -cfile              codon      Codon usage file
   -width              integer    Width of screen

   General qualifiers:
  -help                bool       report command line options. More
                                  information on associated and general
                                  qualifiers can be found with -help -verbose
   

   Mandatory qualifiers Allowed values Default
   [-sequence]
   (Parameter 1) Sequence USA Readable sequence Required
   -frames Select one or more values
   0 (None)
   1 (F1)
   2 (F2)
   3 (F3)
   4 (R1)
   5 (R2)
   6 (R3)
   1,2,3,4,5,6
   [-outfile]
   (Parameter 2) Output file name Output file <sequence>.showorf
   Optional qualifiers Allowed values Default
   -[no]ruler Add a ruler Yes/No Yes
   -[no]plabel Number translations Yes/No Yes
   -[no]nlabel Number DNA sequence Yes/No Yes
   Advanced qualifiers Allowed values Default
   -cfile Codon usage file Codon usage file in EMBOSS data path Ehum.cut
   -width Width of screen Integer 10 or more 50
   
Input file format

   Nucleic acid sequence USA
   
Output file format

   Here is some of the output from the example run. As a sequence with
   high GC content (from Pseudmonas aeruginosa) PAAMIR has several
   overlapping open reading frames.
   
   The true ORFs are 1..109 (amiB partial) 135..1292 (amiC) 1289..1879
   (amiR) 1925..end (amiS partial)

SHOWORF of PAAMIR from 1 to 2167

           ---------|---------|---------|---------|---------|
         1 ggtaccgctggccgagcatctgctcgatcaccaccagccgggcgacggga 50
F1       1 G  T  A  G  R  A  S  A  R  S  P  P  A  G  R  R  E  17
F2       1  V  P  L  A  E  H  L  L  D  H  H  Q  P  G  D  G  N 17
F3       1   Y  R  W  P  S  I  C  S  I  T  T  S  R  A  T  G   16

           ---------|---------|---------|---------|---------|
        51 actgcacgatctacctggcgagcctggagcacgagcgggttcgcttcgta 100
F1      18  L  H  D  L  P  G  E  P  G  A  R  A  G  S  L  R  T 34
F2      18   C  T  I  Y  L  A  S  L  E  H  E  R  V  R  F  V   33
F3      17 T  A  R  S  T  W  R  A  W  S  T  S  G  F  A  S  Y  33

           ---------|---------|---------|---------|---------|
       101 cggcgctgagcgacagtcacaggagaggaaacggatgggatcgcaccagg 150
F1      35   A  L  S  D  S  H  R  R  G  N  G  W  D  R  T  R   50
F2      34 R  R  *  A  T  V  T  G  E  E  T  D  G  I  A  P  G  14
F3      34  G  A  E  R  Q  S  Q  E  R  K  R  M  G  S  H  Q  E 50

......................


           ---------|---------|---------|---------|---------|
      1851 agttgctgggaaacgagccgtccgcctgagcgatccgggccgaccagaac 1900
F1     341  V  A  G  K  R  A  V  R  L  S  D  P  G  R  P  E  Q 357
F2     203   L  L  G  N  E  P  S  A  *  A  I  R  A  D  Q  N   7
F3       5 S  C  W  E  T  S  R  P  P  E  R  S  G  P  T  R  T  21

           ---------|---------|---------|---------|---------|
      1901 aataacaagaggggtatcgtcatcatgctgggactggttctgctgtacgt 1950
F1       1   *  Q  E  G  Y  R  H  H  A  G  T  G  S  A  V  R   15
F2       8 N  N  K  R  G  I  V  I  M  L  G  L  V  L  L  Y  V  24
F3      22  I  T  R  G  V  S  S  S  C  W  D  W  F  C  C  T  L 38

           ---------|---------|---------|---------|---------|
      1951 tggcgcggtgctgtttctcaatgccgtctggttgctgggcaagatcagcg 2000
F1      16 W  R  G  A  V  S  Q  C  R  L  V  A  G  Q  D  Q  R  32
F2      25  G  A  V  L  F  L  N  A  V  W  L  L  G  K  I  S  G 41
F3      39   A  R  C  C  F  S  M  P  S  G  C  W  A  R  S  A   54

           ---------|---------|---------|---------|---------|
      2001 gtcgggaggtggcggtgatcaacttcctggtcggcgtgctgagcgcctgc 2050
F1      33  S  G  G  G  G  D  Q  L  P  G  R  R  A  E  R  L  R 49
F2      42   R  E  V  A  V  I  N  F  L  V  G  V  L  S  A  C   57
F3      55 V  G  R  W  R  *  S  T  S  W  S  A  C  *  A  P  A  3

           ---------|---------|---------|---------|---------|
      2051 gtcgcgttctacctgatcttttccgcagcagccgggcagggctcgctgaa 2100
F1      50   R  V  L  P  D  L  F  R  S  S  R  A  G  L  A  E   65
F2      58 V  A  F  Y  L  I  F  S  A  A  A  G  Q  G  S  L  K  74
F3       4  S  R  S  T  *  S  F  P  Q  Q  P  G  R  A  R  *  R 1

           ---------|---------|---------|---------|---------|
      2101 ggccggagcgctgaccctgctattcgcttttacctatctgtgggtggccg 2150
F1      66 G  R  S  A  D  P  A  I  R  F  Y  L  S  V  G  G  R  82
F2      75  A  G  A  L  T  L  L  F  A  F  T  Y  L  W  V  A  A 91
F3       2   P  E  R  *  P  C  Y  S  L  L  P  I  C  G  W  P   12

           ---------|-------
      2151 ccaaccagttcctcgag 2167
F1      83  Q  P  V  P  R    87
F2      92   N  Q  F  L  E   96
F3      13 P  T  S  S  S     17

Data files

   Showorf uses the codon frequency files to translate the sequence.
   
   The codon usage table is read by default from "Ehum.cut" in the
   'data/CODONS' directory of the EMBOSS distribution. If the name of a
   codon usage file is specified on the command line with the '-cfile'
   option, then this file will first be searched for in the current
   directory and then in the 'data/CODONS' directory of the EMBOSS
   distribution.
   
   To see the available EMBOSS codon usage files, run:

% embossdata -showall

   To fetch one of the codon usage tables (for example 'Emus.cut') into
   your current directory for you to inspect or modify, run:

% embossdata -fetch -file Emus.cut

Notes

References

Warnings

Diagnostic Error Messages

Exit status

   It always exits with status 0.
   
Known bugs

See also

   Program name                          Description
   backtranseq  Back translate a protein sequence
   coderet      Extract CDS, mRNA and translations from feature tables
   getorf       Finds and extracts open reading frames (ORFs)
   marscan      Finds MAR/SAR sites in nucleic sequences
   plotorf      Plot potential open reading frames
   prettyseq    Output sequence with translated ranges
   remap        Display a sequence with restriction cut sites, translation etc
   showseq      Display a sequence with features, translation etc
   transeq      Translate nucleic acid sequences
   wobble       Wobble base plot
   
Author(s)

   This application was written by Alan Bleasby (ableasby@hgmp.mrc.ac.uk)
   
History

Target users

   This program is intended to be used by everyone and everything, from
   naive users to embedded scripts.
   
Comments
