EMBOSS: showorf

Program showorf

Function

Description

It uses codon frequency files to do the translation. You can specify the codon frequency file that you use with the '-cfile' option. The default table is 'Ehum.cut'.

Usage

% showorf
Pretty output of DNA translations
Input sequence: embl:paamir
Select Frames To Translate
         0 : None
         1 : F1
         2 : F2
         3 : F3
         4 : R1
         5 : R2
         6 : R3
Select one or more values [1,2,3,4,5,6]: 
Output file [paamir.showorf]: 

Command line arguments

   Mandatory qualifiers:
  [-sequence]          sequence   Sequence USA
   -frames             menu       Select one or more values
  [-outfile]           outfile    Output file name

   Optional qualifiers:
   -[no]ruler          bool       Add a ruler
   -[no]plabel         bool       Number translations
   -[no]nlabel         bool       Number DNA sequence

   Advanced qualifiers:
   -cfile              codon      Codon usage file
   -width              integer    Width of screen

   General qualifiers:
  -help                bool       report command line options. More
                                  information on associated and general
                                  qualifiers can be found with -help -verbose

Mandatory qualifiers		Allowed values	Default
[-sequence] (Parameter 1)	Sequence USA	Readable sequence	Required
-frames	Select one or more values	0 (None) 1 (F1) 2 (F2) 3 (F3) 4 (R1) 5 (R2) 6 (R3)	1,2,3,4,5,6
[-outfile] (Parameter 2)	Output file name	Output file	<sequence>.showorf
Optional qualifiers		Allowed values	Default
-[no]ruler	Add a ruler	Yes/No	Yes
-[no]plabel	Number translations	Yes/No	Yes
-[no]nlabel	Number DNA sequence	Yes/No	Yes
Advanced qualifiers		Allowed values	Default
-cfile	Codon usage file	Codon usage file in EMBOSS data path	Ehum.cut
-width	Width of screen	Integer 10 or more	50

Input file format

Output file format

The true ORFs are 1..109 (amiB partial) 135..1292 (amiC) 1289..1879 (amiR) 1925..end (amiS partial)

SHOWORF of PAAMIR from 1 to 2167

           ---------|---------|---------|---------|---------|
         1 ggtaccgctggccgagcatctgctcgatcaccaccagccgggcgacggga 50
F1       1 G  T  A  G  R  A  S  A  R  S  P  P  A  G  R  R  E  17
F2       1  V  P  L  A  E  H  L  L  D  H  H  Q  P  G  D  G  N 17
F3       1   Y  R  W  P  S  I  C  S  I  T  T  S  R  A  T  G   16

           ---------|---------|---------|---------|---------|
        51 actgcacgatctacctggcgagcctggagcacgagcgggttcgcttcgta 100
F1      18  L  H  D  L  P  G  E  P  G  A  R  A  G  S  L  R  T 34
F2      18   C  T  I  Y  L  A  S  L  E  H  E  R  V  R  F  V   33
F3      17 T  A  R  S  T  W  R  A  W  S  T  S  G  F  A  S  Y  33

           ---------|---------|---------|---------|---------|
       101 cggcgctgagcgacagtcacaggagaggaaacggatgggatcgcaccagg 150
F1      35   A  L  S  D  S  H  R  R  G  N  G  W  D  R  T  R   50
F2      34 R  R  *  A  T  V  T  G  E  E  T  D  G  I  A  P  G  14
F3      34  G  A  E  R  Q  S  Q  E  R  K  R  M  G  S  H  Q  E 50

......................


           ---------|---------|---------|---------|---------|
      1851 agttgctgggaaacgagccgtccgcctgagcgatccgggccgaccagaac 1900
F1     341  V  A  G  K  R  A  V  R  L  S  D  P  G  R  P  E  Q 357
F2     203   L  L  G  N  E  P  S  A  *  A  I  R  A  D  Q  N   7
F3       5 S  C  W  E  T  S  R  P  P  E  R  S  G  P  T  R  T  21

           ---------|---------|---------|---------|---------|
      1901 aataacaagaggggtatcgtcatcatgctgggactggttctgctgtacgt 1950
F1       1   *  Q  E  G  Y  R  H  H  A  G  T  G  S  A  V  R   15
F2       8 N  N  K  R  G  I  V  I  M  L  G  L  V  L  L  Y  V  24
F3      22  I  T  R  G  V  S  S  S  C  W  D  W  F  C  C  T  L 38

           ---------|---------|---------|---------|---------|
      1951 tggcgcggtgctgtttctcaatgccgtctggttgctgggcaagatcagcg 2000
F1      16 W  R  G  A  V  S  Q  C  R  L  V  A  G  Q  D  Q  R  32
F2      25  G  A  V  L  F  L  N  A  V  W  L  L  G  K  I  S  G 41
F3      39   A  R  C  C  F  S  M  P  S  G  C  W  A  R  S  A   54

           ---------|---------|---------|---------|---------|
      2001 gtcgggaggtggcggtgatcaacttcctggtcggcgtgctgagcgcctgc 2050
F1      33  S  G  G  G  G  D  Q  L  P  G  R  R  A  E  R  L  R 49
F2      42   R  E  V  A  V  I  N  F  L  V  G  V  L  S  A  C   57
F3      55 V  G  R  W  R  *  S  T  S  W  S  A  C  *  A  P  A  3

           ---------|---------|---------|---------|---------|
      2051 gtcgcgttctacctgatcttttccgcagcagccgggcagggctcgctgaa 2100
F1      50   R  V  L  P  D  L  F  R  S  S  R  A  G  L  A  E   65
F2      58 V  A  F  Y  L  I  F  S  A  A  A  G  Q  G  S  L  K  74
F3       4  S  R  S  T  *  S  F  P  Q  Q  P  G  R  A  R  *  R 1

           ---------|---------|---------|---------|---------|
      2101 ggccggagcgctgaccctgctattcgcttttacctatctgtgggtggccg 2150
F1      66 G  R  S  A  D  P  A  I  R  F  Y  L  S  V  G  G  R  82
F2      75  A  G  A  L  T  L  L  F  A  F  T  Y  L  W  V  A  A 91
F3       2   P  E  R  *  P  C  Y  S  L  L  P  I  C  G  W  P   12

           ---------|-------
      2151 ccaaccagttcctcgag 2167
F1      83  Q  P  V  P  R    87
F2      92   N  Q  F  L  E   96
F3      13 P  T  S  S  S     17

Data files

The codon usage table is read by default from "Ehum.cut" in the 'data/CODONS' directory of the EMBOSS distribution. If the name of a codon usage file is specified on the command line with the '-cfile' option, then this file will first be searched for in the current directory and then in the 'data/CODONS' directory of the EMBOSS distribution.

To see the available EMBOSS codon usage files, run:

% embossdata -showall

To fetch one of the codon usage tables (for example 'Emus.cut') into your current directory for you to inspect or modify, run:

% embossdata -fetch -file Emus.cut

Notes

References

Warnings

Diagnostic Error Messages

Exit status

Known bugs

See also

Author(s)

History

Target users

Comments